1. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

(1).Inducer, Repressor, Structural gene

(2). Promotor, Structural gene, Terminator

(3). Repressor, Operator gene, Structural gene

(4). Structural gene, Transposons, Operator gene

2. The lactose present in the growth medium of bacteria is transported to the cell by the action of

(1).Permease

(2). Polymerase

(3). Beta-galactosidase

(4). Acetylase

3. Which of the following statement is correct regarding the process of replication in E.coli?

(1).The DNA dependent DNA polymerase catalyses polymerization in 5’ \(\rightarrow\) 3’ as well as 3’ \(\rightarrow\) 5’ direction.

(2). The DNA dependent DNA polymerase catalyses polymerization in 5’ \(\rightarrow\) 3’ direction.

(3). The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ \(\rightarrow\) 5’.

(4). The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ \(\rightarrow\) 3’.

4. Match List I with List II:
Choose the correct answer from the options given below:

(1).A-II, B-III, C-IV, D-I

(2). A-IV, B-I, C-II, D-III

(3). A-III, B-II, C-I, D-IV

(4). A-III, B-IV, C-I, D-II

5. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5 '

(1).5'AUGUACCGUUUAUAGGGAAGU3 '

(2). 5'ATGTACCGTTTATAGGTAAGT3 '

(3). 5 ' AUGUACCGUUUAUAGGUAAGU3 '

(4). 5'AUGUAAAGUUUAUAGGUAAGU3 '

6. Match List I with List II:

Choose the correct answer from the options given below:

(1).A-III, B-IV, C-I, D-II

(2). A-IV, B-III, C-I, D-II

(3). A-II, B-IV, C-I, D-III

(4). A-III, B-II, C-IV, D-I

7. Who proposed that the genetic code for amino acids should be made up of three nucleotides?

(1).Franklin Stahl,

(2). George Gamow

(3). Francis Crick

(4). Jacque Monod

8. Histones are enriched with -

(1).Phenylalanine & Arginine

(2). Lysine & Arginine

(3). Leucine & Lysine

(4). Phenylalanine & Leucin

9. Which factor is important for termination of transcription?

(1).\(\gamma\) (gamma)

(2). \(\alpha\) (alpha)

(3). \(\sigma\) (sigma)

(4). \(\rho\) (rho)

10. Name the class of enzyme that usually catalyze the following reaction :
S - G + S^# → S + S^# - G
Where, G → a group other than hydrogen
S → a substrate
S^# → another substrate

(1).Ligase

(2). Hydrolase

(3). Lyase

(4). Transferase

11. Given below are two statements
Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable.
Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism.
In the light of the above statements, choose the most appropriate answer from the options given below :

(1).Statement I is incorrect but statement II is correct

(2). Both statement I and statement II are correct

(3). Both statemént I and statement II are incorrect

(4). Statement I is correct but statement II is incorrect

12. Given below are two statements
Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence,
In the light of the above statements, choose the most appropriate answer from the options given bclow:

(1).Statement I is incorrect but Statement II is correct

(2). Both Statement I and Statement II are correct

(3). Both Statement I and Statement II are incorrect

(4). Statement I is correct but Statement II is incorrect

13. Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5 end of hnRNA.
D. Addition of adenine residues at 3 end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below :

(1).C, D, E only

(2). A, B, C only

(3). B, C, D only

(4). B, C, E only

14. Match List - I with List - II

Choose the correet answer from the optionsgiven below :

(1).A-III, B-II, C-IV, D-I

(2). A-II, B-IV, C-I, D-III

(3). A-IV, B-II, C-I, D-III

(4). A-IV, B-III, C-I, D-II

15. Which chromosome in the human genome has the highest number of genes?

(1).Chromosome 10

(2). Chromosome X

(3). ChromosomeY

(4). Chromosome I